Γιορτάζοντας τον θρίαμβο της επιστήμης του mRNA: Η Karikó και ο Weissman κερδίζουν το Nobel Ιατρικής 2023!
Permalink

Γιορτάζοντας τον θρίαμβο της επιστήμης του mRNA: Η Karikó και ο Weissman κερδίζουν το Nobel Ιατρικής 2023!

Σήμερα, στις 2 Οκτωβρίου 2023 κυκλοφόρησε η εξαιρετική είδηση ότι δύο πρωτοπόροι στον τομέα της…

Continue Reading →

1η Αυγούστου: Παγκόσμια ημέρα αφιερωμένη στο ζωτικής σημασίας βιομόριο, RNA!
Permalink

1η Αυγούστου: Παγκόσμια ημέρα αφιερωμένη στο ζωτικής σημασίας βιομόριο, RNA!

Της Δρ. Ανδρούλλας Ν. Μηλιώτου Η 1η Αυγούστου αποτελεί την Παγκόσμια Ημέρα αφιερωμένη σε αυτό…

Continue Reading →

Καύσωνας: Τι πραγματικά συμβαίνει στο σώμα μας τις πιο θερμές μέρες του χρόνου;
Permalink

Καύσωνας: Τι πραγματικά συμβαίνει στο σώμα μας τις πιο θερμές μέρες του χρόνου;

Της Δρ. Ανδρούλλας Ν. Μηλιώτου Mε τον «Κλέωνα» να προελαύνει, η Κύπρος βιώνει ένα ακόμα…

Continue Reading →

Πρόσκληση σε εκδήλωση για την Ημέρα Ιατρικού Επισκέπτη – ΣΙΕΚ και KES College
Permalink

Πρόσκληση σε εκδήλωση για την Ημέρα Ιατρικού Επισκέπτη – ΣΙΕΚ και KES College

Το Σωματείο Ιατρικών Επισκεπτών Κύπρου (ΣΙΕΚ) σε συνεργασία με το Πρόγραμμα Σπουδών «Διοίκηση Ιατρικών Επισκεπτών»…

Continue Reading →

Ας μιλήσουμε για την ανθεκτικότητα στα αντιβιοτικά
Permalink

Ας μιλήσουμε για την ανθεκτικότητα στα αντιβιοτικά

Της Δρ. Ανδρούλλας Ν. Μηλιώτου Φέτος, κατά τη διάρκεια των Εργαστηριακών Ασκήσεων του μαθήματος Φαρμακολογία…

Continue Reading →

Με αφορμή την Παγκόσμια Ημέρα Θαλασσαιμίας στις 8 Μαΐου: Η έρευνα για νέες θεραπευτικές προσεγγίσεις
Permalink

Με αφορμή την Παγκόσμια Ημέρα Θαλασσαιμίας στις 8 Μαΐου: Η έρευνα για νέες θεραπευτικές προσεγγίσεις

Της Δρ. Ανδρούλλας Ν. Μηλιώτου Η 8η Μαΐου κάθε χρόνου είναι αφιερωμένη στα θαλασσαιμικά σύνδρομα,…

Continue Reading →

Ξέρατε ότι το Cranberry μπορεί να σας βοηθήσει να αποφύγετε τις ουρολοιμώξεις;
Permalink

Ξέρατε ότι το Cranberry μπορεί να σας βοηθήσει να αποφύγετε τις ουρολοιμώξεις;

Της Δρ. Ανδρούλλας Ν. Μηλιώτου Δεν πρόκειται πλέον για μύθο. Νέα στοιχεία και ευρήματα από…

Continue Reading →

Happy Birthday DNA! 25 Απριλίου, η Παγκόσμια Ημέρα DNA
Permalink

Happy Birthday DNA! 25 Απριλίου, η Παγκόσμια Ημέρα DNA

Της Δρ. Ανδρούλλας Ν. Μηλιώτου …GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAG CGTATATTAAAGTTGCTGCAGTTAAAAG… Μοιάζει με ασυναρτησίες, αλλά μια τέτοια ακολουθία, το…

Continue Reading →

Δημοσίευση επιστημονικού άρθρου  στο διεθνές, έγκριτο περιοδικό Pharmaceutics και καταχώρηση στη Scholarly Community Encyclopedia  από τη Δρ. Μηλιώτου
Permalink